To detect human SAP 1, a human SAP 1 specific probe was prepared by PCR using the forward primer CCTCTAATGATGGGCAGTTTAAGCT SEQ ID NO 4 and the reverse primer TTTGTCATAATTCATGTTAGGCTTGTTC SEQ ID NO 5 order priligy online Antioxidant constituents from licorice roots isolation, structure elucidation and antioxidative capacity toward LDL oxidation